Archive for July, 2004

Refactoring Keyboards

Sunday, July 25th, 2004

After Thomas cunningly found a cheap way to get a smaller keyboard, I’ve been thinking about keyboards. I try to make myself conscious of how I do things and think about whether there’s a better way. I might not spend a lot of time thinking about keyboards, but I spend thousands of hours each year using one, and several of my friends have had crippling injuries related to keyboard use, so really it does merits some thought.

There’s at least two things to think about. Firstly, what physical input device is most useful for you. I spend a lot of time writing code and navigating code. I’m certainly not typing english text all day long. So it is likely that a keyboard design invented for people typing out memos is optimal for me? Unlikely, I think.

That’s a common problem with design of popular objects – economics causes a worse-is-better situation. Regardless of whether or not qwerty is Best, it’s unlikely to go away quickly because People have learned to use them and have little interest in learning something different. So, they’ll buy qwerty keyboards. And economies of scale makes qwerty keyboards cheap. People don’t choose a keyboard because it is Better, they choose it because it is cheap and familiar and requires no new learning. So that means that if you want to set away from the mainstream you’re going to have to spend more money because economies of scale are no longer shining their light in your direction. (Unless you are cunning like Thomas was)

Secondly, there’s the question of how you set up your software to make the most of your input hardware. I’m a big (x)emacs fan, mainly because it is easily mouldable into a tool which is useful for the work that I do. It becomes a tool for me, customized to allow me to easily do the things which I do every day. I watched myself for a week, noticing which tasks I did most often. Then I automated these tasks, and set up key bindings so that my common tasks were easily reachable with single keystrokes. Now when I want to push source code from my windows machine to the linux box on my desk and compile it, a single keypress launches unison to sync the files, then runs make/scons over ssh. That’s a task which I was doing several times a day. Now it’s a single keypress. I like “do what I mean” keypresses too. For example, I have a key-press that gets me to a shell prompt. I don’t care whether or not I was already running a shell – the computer will start one if needed, or switch to an existing one if possible. I don’t want to be hitting alt-tab, looking at the screen and figuring out how many times I need to keep hitting alt-tab to get to the right application or thinking about where the start menu icon for that program is. Do what I want, computer. But software is malleable and exists in a virtual world. We are physical beings and we communicate with the computer by hitting buttons and sliding around lumps of plastic.

So, back to the physical design question, unfortunately you have to weigh up the fact that you want a device which allows you to efficiently control your computer, but also one which won’t cause you discomfort and injury. Computers can be nasty things because they occupy your brain with interesting things, and you end up ignoring your physical body. In the past, I’ve been so involved in coding that my body has got really really cold. I only noticed when my fingers started getting less responsive from the cold and I started making typing mistakes! I’m really bad at noticing this gradual decrease in body temperature – I ended up putting a digital thermometer next to the computer. Anyway, here’s a quick experiment to get you thinking about physical design – try switching off your monitor and sit in your “at the computer” pose for five minutes. Without the internet to distract your mind, you’ll notice that sitting with your arms out on front of your isn’t a terribly natural or comfortable pose for humans. Now think about how many hours of your life you spend on front of a computer.

I’ve tried a few alternatives to the usual keyboard. I find the Microsoft “ergonomic” split keyboard to be pretty good, and I use one at work. I also have a twiddler chord keyboard, which I can use well enough to type english text at an acceptable rate, but it’d take a reasonable amount of customization to make it useful for programming. Tonight I found the Keybowl which is a kind of gesture keyboard. And there’s always the choice of where to put your keyboard – for example, on the arms of your chair. I also think that foot pedals could be interesting, not least because it’d be easy for me to knock some up and see how useful they are. If you could do shift/ctrl/meta/hyper keys on footswitches, then your fingers could get back to only ever hitting one key at a time. I find that scrollbars are one of the most annoying bits of gui which I have to deal with several times an hour. You have to zero in on a tiny bit of screenspace and carefully drag this wee thing around. A tilting footswitch would be ideal for this. I’d love to play with an eye-tracking system – I wonder if you can build one yourself without accidently burning your retina with a laser .. maybe you’d have to be careful to avoid repetitive looking injuries though. ;-)

Webcams

Monday, July 19th, 2004

I got a Creative Labs NX Pro webcam, but unfortunately there aren’t linux drivers for it yet. I did find a project which is developing a driver for zc030x-based webcams. They’ve managed to grab a still image from a webcam, so that’s hopeful. However, the driver only builds under linux 2.4 at the moment and I’m using 2.6.

First of all, I did a bit of reading about the kernel usb support.

  • There’s a skeleton usb driver (in drivers/usb/usb-skeleton.c). Under Documentation/DocBook there’s an article about the USB system.
  • drivers/usb/media/dabusb.c is quite a clean looking driver
  • USB programmers guide
  • Loads of great articles about porting drivers to the 2.6 kernel

I read through the existing code for the zc030x driver, and used Freemind to organise my notes about it.

Since then, I’ve crashed my computer more times that I can remember. Writing kernel code is very unforgiving. If you make a mistake, the whole computer will probably hang. I’ve ended up adopting a very different, even-more-paranoid-than-usual coding style, and have aliased insmod/rmmod to automatically run sync beforehand! But I’ve been making progress – the driver compiles, loads, creates the /dev file correctly, and responds to incoming data .. but I don’t think the webcam is being initialised properly yet. I need to do more snooping of the datastream under Windows to understand what needs to be sent when.

USB itself has been really nicely designed. The designers have obviously considered real use-cases and designed for these. For example, there are four different modes of data transfer, including isochronous (regular time interval, eg. for a webcam running at 15fps) and bulk transfer (eg. for a usb disk, which wants to use as much bandwidth as is available). When there are multiple devices plugged in to your PC, the USB system itself is responsible for arbitrating who is allowed to use how much bandwidth. The usb system knows that it’s better to drop a webcam frame entirely than to deliver it really late. On the other hand, it knows that it should stop files being copied to my usb storage stick if the webcam wants to send a frame. All of this happens behind the scenes, as far as a programmer is concerned. USB is not just an end-to-end pipe, like rs232 was. There’s a whole bandwidth/device management layer on top of that.

Oh, finally .. learning a new code always takes a bit of effort, but it can be made easier by using decent tools. Xref is a refactoring/navigation tool for C. If you’re working on a C program with emacs, and you’re not using this already then you must enjoy pain. Note that you don’t want to be browsing the kernel headers in /usr/include – you need to use the ones under /lib/modules/version/build. Here’s the options for xref to set this up.

[webcam]
  //  input files and directories (processed recursively)
  ~/Projects/zc0302/
  -D__KERNEL__
  -resetIncludeDirs
  -I /lib/modules/2.6.5-gentoo/build/include/linux
  -I /lib/modules/2.6.5-gentoo/build/include
  -I /lib/modules/2.6.5-gentoo/build/
  //  directory where tag files are stored
  -refs ~/Xrefs/webcam
  //  number of tag files
  -refnum=10

Random

Thursday, July 8th, 2004

Someone finally put christian mythology in a form which I can understand (more here).

Sir Clive Sinclair is developing a new folding bike, competing with things like the Strida. Folding bicycles are cool.

DNA Computing

Tuesday, July 6th, 2004

Backyard DNA computing? Yeah, baby. Doesn’t seem too hard.

First of all, what is DNA computing. Aren’t computers made from metal with CPUs and memory? Yes, they commonly are, but that doesn’t mean that all computers must take that form. After all, a computer is just a compute-r, something which computes answers to problems.

I remember my grandad, who worked in the police, telling me how they used to keep details of criminals on filing cards. On the edge of each card there were a number of punched holes, some punched right the way to the edge. Each punched hole corresponded to some fact about the person – whether they were a burglar or a mugger or things like that. So, if you wanted to pick out all the burglars, you’d take a metal skewer and slide it in through the appropriate hole and lift it up. All the cards whose hole had been punched right to the edge (non-burglars) would stay behind, whilst all the relevant ones would get lifted up. Now, while that a million miles away from how modern “computers” work, it still has some flavour of “computing” a solution to a problem.

Now let’s flip to DNA. It’s a long polymer (poly=many, mer=parts) made up from monomers called nucleotides. Nucleotides come in four flavours (called A, T, C and G) and have two neat properties. Firstly, they can join together into big long chains. Secondly, these chains can get zipped together if there are matching nucleotides on each side (A matches with T, G matches with C). It’s the fact that these nucleotides are fussy about who they zip up next to which makes them interesting as computing devices.

If we’re going to try to solve some “computing” problem using DNA, we’ll have to pick a problem which doesn’t require a keyboard or a monitor, since test-tubes don’t come with them attached. The first problem to be solved in this way was what’s called the Hamiltonian Path problem which, despite the formidable name, is really simple. Imagine a small group of islands, connected by bridges. You start on Starting Island, and your aim is to get to Finish Island by crossing bridges, visiting each island exactly once. Now, depending on how many bridges there are, there may be several ways to do this or there may be no way to do it. So, to play the Hamiltonian Path game, someone describes the islands and bridges to you, and you have to either say “here’s a solution” or “there are no solutions”. When there’s lots of islands, it gets really quite Hard.

Fortunately for us, a bright chap called Leonard Adleman figured out how we can cheat at this game by messing around with DNA in testtubes until we find the answer. He’s a pretty bright guy, famous for being the “A” in the RSA encryption system among other things.

The trick goes like this. For each island, we choose a different 20-mer strand of nucleotides (ie. literally “20 parts”; molecular chemists like to pretend they know greek). It doesn’t really matter too much whether you choose ATCGGCTACTGCATGCTGAA or GGGGAAAATTTTCCCCAAAA for a given island, as long as they are different. You do need quite a lot of each strand though – billions and billions of them. And where do you get them from? Well, you can just buy them. They’re called oligonucleotides (more greek, oligos means “few”). Phone them up, say “hey, can you knock me up some GGAACCTT’s and a few billion ATCCGAT’s please?” and they’ll send you out a little white lump.

Here comes the clever bit. We’re going to build strands of nucleotides which represent the bridges. Let’s assume there’s a bridge from Starting Island to Fire Island. Remember how A and T will stick together, and G and C will stick together? These are called complementary pairs. Our bridge-strand is going to be carefully chosen so that its first half will be complementary to the second half of Starting Island’s nucleotide strand, and the second half of the bridge strand will be complementary to the first half of Fire Island’s strand. That means it can act like sticky tape to join the two together. That’s pretty cool, and it’s the first hint that something a bit like “computation” is going on here. We’ll need strands which correspond to each bridge, and we’ll need quite a lot of copies of them – Adleman used about 30,000,000,000,000,

So we take our island-strands and our bridge-strands and we put them into a test-tube. We give it a bit of a shake and we’re done. Problem solved!

Ahem, well, the problem has been solved but we need to do a bit of work to reveal the answer. What has happened in the test-tube is that bridge strands have joined the island strand together into big chains, each corresponding to a possible route through the islands. And because we started with so many billion copies of each, and we gave the test-tube a pretty good shake, we can be reasonably sure we’ll have plenty of example of each possible route through the islands in our test tube. Unfortunately, most of these routes will not honour the “only visit each island once” rule. However, it’s not hard to get rid of a lot of the wrong answers by selecting only those DNA strands with the right length. If we had 14 islands (like Adleman did) then we can pick out the DNA strands which are 14*20 = 280 nucleotides long. For this, we can use gel electrophoresis which amounts to blasting the DNA strands down through gel using an electric field to persuade them to move. (As an aside, I had an interesting conversation with someone I’d just met in the pub about why you can’t easily use mass spectroscopy for this).

We’re still not quite finished though. Just because our route visited 14 islands doesn’t mean we visited all 14 islands. Maybe we just spun around in a loop between Starting Island and Fire Island. And also, there’s no guarantee that the routes all started and finished in the right place. Again, biochemistry comes to our rescue. It’s not too difficult to pick out these DNA strands which start with Starting Island’s sequence and end with Finish Island’s sequence, thanks to a rather “special” guy called Kary Mullis. He won a Nobel Prize for inventing the PCR reaction, which is a way of selecting particular strands of DNA and making loads of copies of them. As with a lot of great inventions, it’s blindingly obvious with hindsight, but Kary was the first person to conceive of it – largely due to his background in both computer science and chemistry. People had been doing the polymerase reaction for ages (well, we humans had been doing it for millions of years, but we only noticed in the past few decades). The polymerase reaction builds up a (complementary) copy of an exiting DNA strand, so you end up effectively with twice as much. Mr Mullis’s stroke of genius was to do it again. And again. And again. And again, until you disappeared under a mountain of rice and you can’t find your chessboard any more. You should try and borrow a copy of his book, “Surfing Naked in the Mind Field” for a mind-altering view of the world. I think I left my copy in Miami somewhere, but I’m left with the memory of a very unique person. Oh, yeah. Special.

Once we’ve picked out all the strands which start and end in the right place, we go through the remaining pile firstly discarding those which never visited Fire Island, then those which missed out on the delights of Infinite Chocolate Island, and so on until we are left with a somewhat reduced pile of routes/strands. This selection process is done with some glass beads and some molecular glue. If you want to pick out strands containing the sequence AAAA, you can “glue” some TTTT strands (the complement) to some glass beads. Then you pour the solution containg your DNA over the beads, and the AAAA-containing strands will stick to them. Then you scrape them off with a spoon. Well, that’s close enough.

All of the remaining strands represent a route which visited all the islands exactly once. If you had microscopic fingers, you could pick up a strand of DNA and shout “Eureka, I finally have the answer!”. But, if your fingers are human-sized like mine, you will need a final bit of biochemistry to reveal the answer. There’s several different ways to read out the sequence of nucleotides which are left – Adleman used Graduated PCR. But at the end of the day (seven days in Adleman’s case) you end up with answer. Either there was a path through all the islands in which case you’ll have almost certainly found it (as in, really really almost certainly), or there wasn’t in which case you ended up with a sad empty test-tube.

So that’s it. That’s how you can perform a computation in a test-tube using DNA. There’s so much interesting stuff in this area. For a start, just because we can solve an island-hopping problem doesn’t neccesarily mean we can use DNA to solve every conceivable computing problem. It turns out, however, that DNA is that powerful. And, for certain types of problems, it may be a lot quicker than existing electronic computers. After all, you don’t need to buy a faster processor – you just use a bigger testtube! You can’t really use C++ to write DNA programs, so how do you encode an arbitary problem onto strands of DNA? It’s also interesting to look at how the imperfect nature of a biochemical reaction affects the usefulness of the results we get. Our electronic computers aren’t perfect theoretical beasts either – they get hit by alpha particles and have to endure power supply fluctuations. Finally, and this is where my interest really kicks in, can I coin the phrase “backyard dna computing” (cf. bymc) to describe what I’m going to try Real Soon Now -…